PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: rno-piR-3531

  • Accession:
  • rno-piR-3531
  • Organism Name:
  • Rattus norvegicus
  • Sequence Length:
  • 24
  • Alignments to rn6:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

rno-piR-3531 Sequence
Based on genomic context


TTCAAGAATGGAGAGGCCTGAGGG

rno-piR-3531 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ763832.1 piR-179154 piR-rno-36489 rat_piRNA_3531 rno_piR_036015 URS000023567B

rno-piR-3531 Tissue Expression

Box plot visualization related to the piRNA expression found in datasets processed by the development team of piRNAdb. Categories and tissues may vary depending to the organism selected and availability to download the sample data. More information related to the methodology and softwares, access the specific page "About": Tissue Expression.
Raw counts and normalized by TMM are available.

Display More Information...

None rno-piR-3531 Genomic Feature(s) Found to Draw the Cloud!

rno-piR-3531 Target Site(s) Cloud

This feature allow the user and researcher to visualize the predited targets by this piRNA in a objective way, it displays the genes based on the amount of complementary sites to the piRNA sequence following specific and updated rules.
To get more information about rules, cut-off and data source, access the specific page "FAQ/Help", item: piRNA Target Selection Criteria Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • Porcn
  • Rai2
  • Soat1
  • 1
  • 1

rno-piR-3531 Target Gene Ontology Terms

We develop this feature to associate gene ontology terms found in databases and literature to predicted target genes to this piRNA. It contain information about the gene ontology term title and amount of genes that is related to one determined term.
Place the cursor over the term if it appear truncated.

Display More Information...

rno-piR-3531 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

rno-piR-3531 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
16778019 small RNA-seq testis

rno-piR-3531 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Characterization of the piRNA complex from rat testes
  • Journal
  • Science - 2006
  • Author
  • Lau NC; Seto AG; Kim J; Kuramochi-Miyagawa S; Nakano T; Bartel DP; Kingston RE
  • Pubmed
  • 16778019

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy