PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: piR-dme-28733
This access code belongs to another piRNA database. On piRNAdb we use the following access code: dme-piR-14995

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: dme-piR-14995

  • Accession:
  • dme-piR-14995
  • Organism Name:
  • Drosophila melanogaster
  • Sequence Length:
  • 25
  • Alignments to dm6:
  • 23
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

dme-piR-14995 Sequence
Based on genomic context


TCTTCACGTGCCTCCAAGCATCCTC

dme-piR-14995 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

piR-dme-28733

dme-piR-14995 Tissue Expression

Box plot visualization related to the piRNA expression found in datasets processed by the development team of piRNAdb. Categories and tissues may vary depending to the organism selected and availability to download the sample data. More information related to the methodology and softwares, access the specific page "About": Tissue Expression.
Raw counts and normalized by TMM are available.

Display More Information...

None dme-piR-14995 Genomic Feature(s) Found to Draw the Cloud!

None dme-piR-14995 Target Site(s) Found to Draw the Cloud!

None dme-piR-14995 Target Gene Ontology Terms Found!

dme-piR-14995 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

dme-piR-14995 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
17346786 Immunoprecipitation ovary

dme-piR-14995 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila
  • Journal
  • Cell - 2007
  • Author
  • Brennecke J; Aravin AA; Stark A; Sachidanandam R; Dus M, Hannon GJ
  • Pubmed
  • 17346786

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy