PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: mmu-piR-39266

  • Accession:
  • mmu-piR-39266
  • Organism Name:
  • Mus musculus
  • Sequence Length:
  • 30
  • Alignments to mm10:
  • 4
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 0
  • Papers Describing:
  • 0

mmu-piR-39266 Sequence
Based on genomic context


TGATAGTCTTCTGGCACAATACGTAATTGA

mmu-piR-39266 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ688135.1 mmu_piRNA_39653 mmu_piR_011493 piR-103457 piR-mmu-17406 URS0000526FC3

No mmu-piR-39266 Expression Found to Draw the Box Plot!

mmu-piR-39266 Genomic Feature(s) Overlap Cloud

This feature allow the user and researcher to visualize the genes associated to this piRNA in a objective way, it displays the genes based on the amount of alignments overlapping the gene coordinates.
Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • Gm14152
  • 1
  • 1

None mmu-piR-39266 Target Site(s) Found to Draw the Cloud!

None mmu-piR-39266 Target Gene Ontology Terms Found!

mmu-piR-39266 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

No mmu-piR-39266 Dataset Found!

No mmu-piR-39266 Reference Found!

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy