PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: mmu-piR-39251

  • Accession:
  • mmu-piR-39251
  • Organism Name:
  • Mus musculus
  • Sequence Length:
  • 27
  • Alignments to mm10:
  • 9
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 0
  • Papers Describing:
  • 0

mmu-piR-39251 Sequence
Based on genomic context


GGGATTAACTTCACCTATCGGGGGCAG

mmu-piR-39251 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ688150.1 mmu_piRNA_39640 mmu_piR_011504 piR-103472 piR-mmu-17421 URS00004BF594

No mmu-piR-39251 Expression Found to Draw the Box Plot!

None mmu-piR-39251 Genomic Feature(s) Found to Draw the Cloud!

None mmu-piR-39251 Target Site(s) Found to Draw the Cloud!

None mmu-piR-39251 Target Gene Ontology Terms Found!

mmu-piR-39251 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

No mmu-piR-39251 Dataset Found!

No mmu-piR-39251 Reference Found!

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy