PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: hsa_piRNA_7040
This access code belongs to another piRNA database. On piRNAdb we use the following access code: hsa-piR-18007

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: hsa-piR-18007

  • Accession:
  • hsa-piR-18007
  • Organism Name:
  • Homo sapiens
  • Sequence Length:
  • 26
  • Alignments to hg38:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

hsa-piR-18007 Sequence
Based on genomic context


TGGCCCTGATCGTGGAGTGAGTCCTA

hsa-piR-18007 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ587919.1 hsa_piRNA_7040 hsa_piR_013220 piR-55031 piR-hsa-18166 URS000058241E

No hsa-piR-18007 Expression Found to Draw the Box Plot!

hsa-piR-18007 Genomic Feature(s) Overlap Cloud

This feature allow the user and researcher to visualize the genes associated to this piRNA in a objective way, it displays the genes based on the amount of alignments overlapping the gene coordinates.
Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • RBM33
  • 1
  • 1

None hsa-piR-18007 Target Site(s) Found to Draw the Cloud!

None hsa-piR-18007 Target Gene Ontology Terms Found!

hsa-piR-18007 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

hsa-piR-18007 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
16751776 Immunoprecipitation testis

hsa-piR-18007 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • A germline-specific class of small RNAs binds mammalian Piwi proteins.
  • Journal
  • Nature - 2006
  • Author
  • Girard A; Sachidanandam R; Hannon GJ; Carmell MA
  • Pubmed
  • 16751776

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy