PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: hsa_piRNA_26618
This access code belongs to another piRNA database. On piRNAdb we use the following access code: hsa-piR-27475

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: hsa-piR-27475

  • Accession:
  • hsa-piR-27475
  • Organism Name:
  • Homo sapiens
  • Sequence Length:
  • 30
  • Alignments to hg38:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

hsa-piR-27475 Sequence
Based on genomic context


GCCTCTTTCAACGTCACACCTTTCAACGTC

hsa-piR-27475 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ597387.1 hsa_piRNA_26618 piR-35453 piR-hsa-27662 URS0000128240

No hsa-piR-27475 Expression Found to Draw the Box Plot!

None hsa-piR-27475 Genomic Feature(s) Found to Draw the Cloud!

hsa-piR-27475 Target Site(s) Cloud

This feature allow the user and researcher to visualize the predited targets by this piRNA in a objective way, it displays the genes based on the amount of complementary sites to the piRNA sequence following specific and updated rules.
To get more information about rules, cut-off and data source, access the specific page "FAQ/Help", item: piRNA Target Selection Criteria Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • IMPDH1
  • 8
  • 8

hsa-piR-27475 Target Gene Ontology Terms

We develop this feature to associate gene ontology terms found in databases and literature to predicted target genes to this piRNA. It contain information about the gene ontology term title and amount of genes that is related to one determined term.
Place the cursor over the term if it appear truncated.

Display More Information...

hsa-piR-27475 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

hsa-piR-27475 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
16751776 Immunoprecipitation testis

hsa-piR-27475 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • A germline-specific class of small RNAs binds mammalian Piwi proteins.
  • Journal
  • Nature - 2006
  • Author
  • Girard A; Sachidanandam R; Hannon GJ; Carmell MA
  • Pubmed
  • 16751776

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy