PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: hsa-piR-32827

  • Accession:
  • hsa-piR-32827
  • Organism Name:
  • Homo sapiens
  • Sequence Length:
  • 28
  • Alignments to hg38:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

hsa-piR-32827 Sequence
Based on genomic context


GTAGTTTTGGTATAGTGGTGAGCATAAC

No hsa-piR-32827 Alias Found!

No hsa-piR-32827 Expression Found to Draw the Box Plot!

None hsa-piR-32827 Genomic Feature(s) Found to Draw the Cloud!

None hsa-piR-32827 Target Site(s) Found to Draw the Cloud!

None hsa-piR-32827 Target Gene Ontology Terms Found!

hsa-piR-32827 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

hsa-piR-32827 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
23376363 small RNA-seq liver

hsa-piR-32827 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Deep sequencing of small RNA transcriptome reveals novel non-coding RNAs in hepatocellular carcinoma
  • Journal
  • Journal of Hepatology - 2013
  • Author
  • Law PT; Qin H; Ching AK; Lai KP; Co NN; He M; Lung RW; Chan AW; Chan TF; Wong N
  • Pubmed
  • 23376363

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy