PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: cgr_piR_022820
This access code belongs to another piRNA database. On piRNAdb we use the following access code: cgr-piR-2807

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: cgr-piR-2807

  • Accession:
  • cgr-piR-2807
  • Organism Name:
  • Cricetulus griseus
  • Sequence Length:
  • 24
  • Alignments to crigri1:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

cgr-piR-2807 Sequence
Based on genomic context


AAGATTTTAGAATATAGGGATTTA

cgr-piR-2807 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

cgr_piR_022820 KC657143.1 URS000060F9CE

No cgr-piR-2807 Expression Found to Draw the Box Plot!

None cgr-piR-2807 Genomic Feature(s) Found to Draw the Cloud!

None cgr-piR-2807 Target Site(s) Found to Draw the Cloud!

None cgr-piR-2807 Target Gene Ontology Terms Found!

cgr-piR-2807 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

cgr-piR-2807 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
23639388 small RNA-seq ovary

cgr-piR-2807 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Prediction of transcribed PIWI-interacting RNAs from CHO RNAseq data
  • Journal
  • Journal of Biotechnology - 2013
  • Author
  • Gerstl MP; Hackl M; Graf AB; Borth N; Grillari J
  • Pubmed
  • 23639388

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy