PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: cgr-piR-660

  • Accession:
  • cgr-piR-660
  • Organism Name:
  • Cricetulus griseus
  • Sequence Length:
  • 26
  • Alignments to crigri1:
  • 2
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

cgr-piR-660 Sequence
Based on genomic context


GGGACTGAGAGATGGCTTAGTGGTTA

cgr-piR-660 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

cgr_piR_024967 KC659290.1 URS00004449AB

No cgr-piR-660 Expression Found to Draw the Box Plot!

cgr-piR-660 Genomic Feature(s) Overlap Cloud

This feature allow the user and researcher to visualize the genes associated to this piRNA in a objective way, it displays the genes based on the amount of alignments overlapping the gene coordinates.
Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • Tspan3
  • 1
  • 1

None cgr-piR-660 Target Site(s) Found to Draw the Cloud!

None cgr-piR-660 Target Gene Ontology Terms Found!

cgr-piR-660 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

cgr-piR-660 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
23639388 small RNA-seq ovary

cgr-piR-660 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Prediction of transcribed PIWI-interacting RNAs from CHO RNAseq data
  • Journal
  • Journal of Biotechnology - 2013
  • Author
  • Gerstl MP; Hackl M; Graf AB; Borth N; Grillari J
  • Pubmed
  • 23639388

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy