PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: cel-piR-1603

  • Accession:
  • cel-piR-1603
  • Organism Name:
  • Caenorhabditis elegans
  • Sequence Length:
  • 21
  • Alignments to ce11:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

cel-piR-1603 Sequence
Based on genomic context


TTGGAAGAAGTCAAAGTCATG

cel-piR-1603 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

21ur-14208 NR_067359.1 piR-cel-14208 URS00000B8CC4

No cel-piR-1603 Expression Found to Draw the Box Plot!

None cel-piR-1603 Genomic Feature(s) Found to Draw the Cloud!

cel-piR-1603 Target Site(s) Cloud

This feature allow the user and researcher to visualize the predited targets by this piRNA in a objective way, it displays the genes based on the amount of complementary sites to the piRNA sequence following specific and updated rules.
To get more information about rules, cut-off and data source, access the specific page "FAQ/Help", item: piRNA Target Selection Criteria Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • C11G10.3
  • C14H10.3
  • C18F10.2
  • C26D10.7
  • F15H9.1
  • F44A2.3
  • F44E7.7
  • R02D5.13
  • Y110A2AL.7
  • Y48C3A.3
  • Y53G8B.2
  • cdh-4
  • eff-1
  • hrpf-1
  • lact-7
  • ltd-1
  • pfd-5
  • polq-1
  • set-22
  • set-27
  • ugt-62
  • unc-53
  • wrt-9
  • ztf-30
  • 1
  • 7

cel-piR-1603 Target Gene Ontology Terms

We develop this feature to associate gene ontology terms found in databases and literature to predicted target genes to this piRNA. It contain information about the gene ontology term title and amount of genes that is related to one determined term.
Place the cursor over the term if it appear truncated.

Display More Information...

cel-piR-1603 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

cel-piR-1603 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
9851916 RNA-seq whole genome

cel-piR-1603 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Genome sequence of the nematode C. elegans: a platform for investigating biology
  • Journal
  • Science - 1998
  • Author
  • C. elegans Sequencing Consortium
  • Pubmed
  • 9851916

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy