PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home

piRNA: cel-piR-1514

  • Accession:
  • cel-piR-1514
  • Organism Name:
  • Caenorhabditis elegans
  • Sequence Length:
  • 21
  • Alignments to ce11:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

cel-piR-1514 Sequence
Based on genomic context


TTCTAAGGTGATCATTAATTG

cel-piR-1514 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

21ur-12046 NR_067448.1 piR-cel-12046 URS000060E2B2

No cel-piR-1514 Expression Found to Draw the Box Plot!

None cel-piR-1514 Genomic Feature(s) Found to Draw the Cloud!

None cel-piR-1514 Target Site(s) Found to Draw the Cloud!

None cel-piR-1514 Target Gene Ontology Terms Found!

cel-piR-1514 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

cel-piR-1514 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
9851916 RNA-seq whole genome

cel-piR-1514 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Genome sequence of the nematode C. elegans: a platform for investigating biology
  • Journal
  • Science - 1998
  • Author
  • C. elegans Sequencing Consortium
  • Pubmed
  • 9851916

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy