PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: URS000035A954
This access code belongs to another piRNA database. On piRNAdb we use the following access code: mmu-piR-39283

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: mmu-piR-39283

  • Accession:
  • mmu-piR-39283
  • Organism Name:
  • Mus musculus
  • Sequence Length:
  • 30
  • Alignments to mm10:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 0
  • Papers Describing:
  • 0

mmu-piR-39283 Sequence
Based on genomic context


TACAGCAAATGGGACACAGTACTTGCCCTC

mmu-piR-39283 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ688118.1 mmu_piRNA_39667 mmu_piR_011481 piR-103440 piR-mmu-17387 URS000035A954

No mmu-piR-39283 Expression Found to Draw the Box Plot!

None mmu-piR-39283 Genomic Feature(s) Found to Draw the Cloud!

None mmu-piR-39283 Target Site(s) Found to Draw the Cloud!

None mmu-piR-39283 Target Gene Ontology Terms Found!

mmu-piR-39283 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

No mmu-piR-39283 Dataset Found!

No mmu-piR-39283 Reference Found!

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy