PIWI-interacting RNA (piRNA) Database - piRNAdb

piRNA database logo
Show Menu
  • Home
  • About
  • Browse
  • Search
  • Download
  • FAQ/Help
  • Contact
  • piRNA DB
  • home
You are trying to access: DQ706870.1
This access code belongs to another piRNA database. On piRNAdb we use the following access code: mmu-piR-20532

This feature of piRNAdb have the major objective to make easier to access the piRNA information. It provides the automatic translation of different piRNA alias from other databases to the code that we use on piRNAdb and provide the redirection to the piRNA information page.

Display More Information...

piRNA: mmu-piR-20532

  • Accession:
  • mmu-piR-20532
  • Organism Name:
  • Mus musculus
  • Sequence Length:
  • 27
  • Alignments to mm10:
  • 1
  • Community Agree / Disagree:
  • 0 / 0
  • Community Comments:
  • 0
  • Datasets Found:
  • 1
  • Papers Describing:
  • 1

mmu-piR-20532 Sequence
Based on genomic context


TATATATATATTTCACTACTTAGAGGA

mmu-piR-20532 Aliases

In this section we provide all access alias for this piRNA in other databases. It is usual that databases store the same sequences of RNAs, but using different accession codes and identification. The association of a piRNA on our database and on another database is made by the comparison of the base sequence. Now, we have alias for piRNAs stored on the following databases: NCBI, ENA, piRNABank, piRBase, piRNAQuest and RNAdb.

Display More Information...

DQ706870.1 mmu_piRNA_21717 mmu_piR_024122 piR-122192 piR-mmu-37468 URS0000048104

No mmu-piR-20532 Expression Found to Draw the Box Plot!

None mmu-piR-20532 Genomic Feature(s) Found to Draw the Cloud!

mmu-piR-20532 Target Site(s) Cloud

This feature allow the user and researcher to visualize the predited targets by this piRNA in a objective way, it displays the genes based on the amount of complementary sites to the piRNA sequence following specific and updated rules.
To get more information about rules, cut-off and data source, access the specific page "FAQ/Help", item: piRNA Target Selection Criteria Genes with a bigger font size and more vivid orange color have a higher amount of overlapping alignments, and a smaller font size and grey tone color is associated with a few amount of overlapping alignments.

Display More Information...

  • Arpp21
  • Eya4
  • Gm2061
  • 1
  • 34

mmu-piR-20532 Target Gene Ontology Terms

We develop this feature to associate gene ontology terms found in databases and literature to predicted target genes to this piRNA. It contain information about the gene ontology term title and amount of genes that is related to one determined term.
Place the cursor over the term if it appear truncated.

Display More Information...

mmu-piR-20532 Feedback

Do you believe this is a real piRNA?
More important than just use the information provided, here the piRNA enthuast user and the researcher are able to provide their opinion about this specific piRNA. Is provided a form to write your comments and a simplified pool. This feature was developed to increase the connection and integration of different or equal opinions about this specific piRNA.

Display More Information...

Yes
0
No
0
Leave a Comment
#
  • Newest
None comments to show. Be the first to comment!

mmu-piR-20532 Dataset

In this section we provide information related to the dataset where this piRNA was found. If there is more than on item available, it means that this piRNA was found in more than one project. It is important to cite and give credits to all the authors that have found this RNA sequence.

Display More Information...

Reference Methods Tissue
16778019 small RNA-seq testis

mmu-piR-20532 Reference

Provide information related to the published papers that use this piRNA. It is different to the "Dataset" section above because any paper that uses this piRNA, like evaluating the expression, mutation or variation, may be displayed here.

Display More Information...

  • Title
  • Characterization of the piRNA complex from rat testes
  • Journal
  • Science - 2006
  • Author
  • Lau NC; Seto AG; Kim J; Kuramochi-Miyagawa S; Nakano T; Bartel DP; Kingston RE
  • Pubmed
  • 16778019

piRNA Database version 1.8.0

MOC - Molecular Oncology Center

View our cookie data policy